In contrast, TE allows for repeatable and real-time assessment of liver stiffness, which correlates strongly with fibrosis stages [53]
A new function for selenoproteins as peroxynitrite reductase
Other diseases Lactate metabolism plays diverse roles across a range of diseases beyond cancer, including cardiovascular, neurological, metabolic, and inflammatory conditions
The following shRNA constructs were used (See also Key Resources Table): shGFP, shFOXO4-1: TRCN0000039720, Mature sequence: CCAGCTTCAGTCAGCAGTTAT, shFOXO4-2: TRCN0000039721, Mature sequence: CGTCCACGAAGCAGTTCAAAT, shFOXO4(mouse): TRCN0000071560, Mature sequence: GATCTGGATCTTGATATGTAT, shp53-1: TRCN0000003753, Mature sequence: CGGCGCACAGAGGAAGAGAAT and shp53-2: TRCN0000003754, Mature sequence: TCAGACCTATGGAAACTACTT
additional active analogues were synthesized with improved metabolic stability, blood brain barrier permeability, and oral activity
Mutations in SEC63 cause autosomal dominant polycystic liver disease
